Getting Over the Code Delusion: On the Demise of DNA as Destiny
sigmundcarlandalfred.wordpress.com
When it emerged a few years ago that humans and chimpanzees shared, by some measures, 98 or 99 percent of their DNA, a good deal of verbal hand-wringing and chest-beating ensued. How could we hold our heads up with high-browed, post-simian dignity when, as the New Scientist reported in 2003, “chimps are human”? If the DNA of the two species is nearly the same, and if, as most everyone seemed to believe, DNA is destiny, what remained to make us special?
Such was the fretting on the human side, anyway. To be truthful, the chimps didn’t seem much interested. And their disinterest, it turns out, was far more fitting than our angst.
In 1992, Nobel prize-winning geneticist Walter Gilbert wrote that you and I will one day hold up a CD containing our DNA sequence and say, “Here is a human being; it’s me!” His essay was entitled “A Vision of the Grail.” Today one can only wonder how we became so invested in the almost sacred importance of an abstract and one-dimensional genetic code — a code so thinly connected to the full-fleshed reality of our selves that its entire import could be captured in a skeletal string of four repeating letters, like so:
ATGCGATCTGTGAGCCGAGTCTTTAAGTTCATTGCAATG
It’s true that the code, as it was understood at the height of the genomic era, had some grounding in material reality. Each of the four different letters stands for one of the four nucleotide bases constituting the DNA sequence. And each group of three successive letters (referred to as a “codon”) potentially represents an amino acid, a constituent of protein. The idea was that the bases in a protein-coding DNA sequence, or gene, led to the synthesis of the corresponding sequence of amino acids in a protein. And proteins, folded into innumerable shapes, play a decisive role in virtually all living processes. By specifying the production of proteins, genes were presumed to be bearers of the blueprint, or master program, or molecular instruction book of our lives. As Richard Dawkins summed up in his 1986 book The Blind Watchmaker:
There is a sense, therefore, in which the three-dimensional coiled shape of a protein is determined by the one-dimensional sequence of code symbols in the DNA…. The whole translation, from strictly sequential DNA ROM [read-only memory] to precisely invariant three-dimensional protein shape, is a remarkable feat of digital information technology.